What is a universal spacer sequence and how does it affect demultiplexing?
For library designs that include an identical sequence between adapter and barcode, e.g. probe-based linear barcoded adapters samples, lima offers a special mode that is activated if it finds a shared prefix sequence among all provided barcode sequences. Example:
>custombc1
ACATGACTGTGACTATCTCACACATATCAGAGTGCG
>custombc2
ACATGACTGTGACTATCTCAACACACAGACTGTGAG
In this case, lima detects the shared prefix ACATGACTGTGACTATCTCA
and removes it internally from all barcodes. Subsequently, it increases the window size by the length L
of the prefix sequence. If --window-size-bp N
is used, the actual window size is L + N
. If --window-size-mult M
is used, the actual window size is (L + |bc|) * M
.
Because the alignment is semi-global, a leading reference gap can be added without any penalty to the barcode score.