Link Search Menu Expand Document

What is a universal spacer sequence and how does it affect demultiplexing?

For library designs that include an identical sequence between adapter and barcode, e.g. probe-based linear barcoded adapters samples, lima offers a special mode that is activated if it finds a shared prefix sequence among all provided barcode sequences. Example:

>custombc1
ACATGACTGTGACTATCTCACACATATCAGAGTGCG
>custombc2
ACATGACTGTGACTATCTCAACACACAGACTGTGAG

In this case, lima detects the shared prefix ACATGACTGTGACTATCTCA and removes it internally from all barcodes. Subsequently, it increases the window size by the length L of the prefix sequence. If --window-size-bp N is used, the actual window size is L + N. If --window-size-mult M is used, the actual window size is (L + |bc|) * M.

Because the alignment is semi-global, a leading reference gap can be added without any penalty to the barcode score.


THIS WEBSITE AND CONTENT AND ALL SITE-RELATED SERVICES, INCLUDING ANY DATA, ARE PROVIDED "AS IS," WITH ALL FAULTS, WITH NO REPRESENTATIONS OR WARRANTIES OF ANY KIND, EITHER EXPRESS OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, ANY WARRANTIES OF MERCHANTABILITY, SATISFACTORY QUALITY, NON-INFRINGEMENT OR FITNESS FOR A PARTICULAR PURPOSE. YOU ASSUME TOTAL RESPONSIBILITY AND RISK FOR YOUR USE OF THIS SITE, ALL SITE-RELATED SERVICES, AND ANY THIRD PARTY WEBSITES OR APPLICATIONS. NO ORAL OR WRITTEN INFORMATION OR ADVICE SHALL CREATE A WARRANTY OF ANY KIND. ANY REFERENCES TO SPECIFIC PRODUCTS OR SERVICES ON THE WEBSITES DO NOT CONSTITUTE OR IMPLY A RECOMMENDATION OR ENDORSEMENT BY PACIFIC BIOSCIENCES.