Link Search Menu Expand Document

How can I demultiplex IsoSeq data?

Even if you only want to remove IsoSeq primers, lima is the tool of choice.

  1. Remove all duplicate sequences.
  2. Annotate sequence names with a 5p or 3p suffix. Example:
     >primer_5p
     AAGCAGTGGTATCAACGCAGAGTACATGGGG
     >sample_brain_3p
     AAGCAGTGGTATCAACGCAGAGTACCACATATCAGAGTGCG
     >sample_liver_3p
     AAGCAGTGGTATCAACGCAGAGTACACACACAGACTGTGAG
    
  3. Use the --isoseq mode. Run in combination with --peek-guess to remove spurious false positive.
  4. Output will be only different pairs with a 5p and 3p combination:
     demux.primer_5p--sample_brain_3p.bam
     demux.primer_5p--sample_liver_3p.bam
    

Those options are very conservative to remove any spurious and ambiguous calls, in order to guarantee that only proper asymmetric (barcoded) primer are used in downstream analyses. Good libraries reach >75% CCS reads passing lima filters.


THIS WEBSITE AND CONTENT AND ALL SITE-RELATED SERVICES, INCLUDING ANY DATA, ARE PROVIDED "AS IS," WITH ALL FAULTS, WITH NO REPRESENTATIONS OR WARRANTIES OF ANY KIND, EITHER EXPRESS OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, ANY WARRANTIES OF MERCHANTABILITY, SATISFACTORY QUALITY, NON-INFRINGEMENT OR FITNESS FOR A PARTICULAR PURPOSE. YOU ASSUME TOTAL RESPONSIBILITY AND RISK FOR YOUR USE OF THIS SITE, ALL SITE-RELATED SERVICES, AND ANY THIRD PARTY WEBSITES OR APPLICATIONS. NO ORAL OR WRITTEN INFORMATION OR ADVICE SHALL CREATE A WARRANTY OF ANY KIND. ANY REFERENCES TO SPECIFIC PRODUCTS OR SERVICES ON THE WEBSITES DO NOT CONSTITUTE OR IMPLY A RECOMMENDATION OR ENDORSEMENT BY PACIFIC BIOSCIENCES.